Title page for etd-0520114-164408


[Back to Results | New Search]

URN etd-0520114-164408
Author Chun-chih Weng
Author's Email Address wale0857@hotmail.com
Statistics This thesis had been viewed 5559 times. Download 0 times.
Department Marine Biotechnology and Resources
Year 2013
Semester 2
Degree Master
Type of Document
Language zh-TW.Big5 Chinese
Title Expression of the Vibrio phage ΦA318 RNA polymerase
Date of Defense 2014-05-30
Page Count 141
Keyword
  • Vibrio Bacteriophage
  • phage Promoters
  • RNA polymerase
  • Abstract   In aquaculture Vibrio is a major microbial pathogen, Highest death rate may be 100%. ΦA318 is a newly discovered Vibrio phage in our lab, which is characterized by with high efficiency to lyze its host Vibrio alginolyticus (ATCC 17749). After the whole genome analysis, presumably its RNA polymerase (RNAP) activity differs from the T7, SP6 and K11 phages. In order to express RNAP for biochemical characterization and bio-reagent usage. I cloned ΦA318 RNAP, which was fused with a poly-His at its N-terminus to facilitate protein purification. The purified RNAP has the highest specific activity of 365 U/mg at 37oC. The best promoter for this RNAP was    TTTTCTCCTATAGGGCAACTTTATT, which is unique and suitable for bio-reagent market. I also screened RNAP crystallization conditions. The results showed three crystal forms: microcrystalline, needles, and orthorombic crystal form. It will be further used to resolve the atomic structure of this RNAP.
    Advisory Committee
  • Chi-Hsin Hsu - chair
  • Ping-Jyun Sung - co-chair
  • Min-Ying Wang - co-chair
  • Ming-Wei Lu - advisor
  • Chan-Shing Lin - advisor
  • Files
  • etd-0520114-164408.pdf
  • Indicate in-campus at 99 year and off-campus access at 99 year.
    Date of Submission 2014-06-25

    [Back to Results | New Search]


    Browse | Search All Available ETDs

    If you have more questions or technical problems, please contact eThesys